CF504279

Overview
NameCF504279
Unique NameCF504279
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length389
Alignments
Feature NameTypeLocationAnalysis
CF504279_ssr27 microsatellite CF504279_ssr27:27..42.
CF504279_ssr242 microsatellite CF504279_ssr242:242..253.
Csv1_Contig532 contig Csv1_Contig532:1..389. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-768 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_E03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504279 ID=CF504279|Name=CF504279|organism=Citrus sinensis|type=EST|length=389bp
CTCTTTGCTTGCCCTCTATCGAATTCCTCTCTCTCTCTCTCTGTCTCTGT
TTCTCTAATTAGTCGCCAAAACCCAATCATCATCAGCAAGTCTGCTTCAT
CATCAGCCATGGCCGAGGACACGCAAAAGCCAGCTGCAGCCGAGGAAGTT
GCGGTGGAGAAACCAGTCGCTGAGAAGGAGAAAGAACAGGCACCTGCTCC
TGTACCTGAGCCTGAAGCACCGGGGAAGCCGACTGAGGAATCTGCTGCTG
CTGGTGTTGAAGAAGTGGCTGAGCCTGAGAAACCGAAGCCCGTCGAGGAA
GAAAAGATTGCTCAATCGGCTTCTTTCAAAGAAGAGAGCAACGTTGGTGG
GGAGTTACCCGACCCTCAGAAGAAAGCTCTTGATGAGCT
back to top