CF504288

Overview
NameCF504288
Unique NameCF504288
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length102
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-777 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_E12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504288 ID=CF504288|Name=CF504288|organism=Citrus sinensis|type=EST|length=102bp
CGGGGTGCAGGTGGAAACCTCCTTTGTTAGGTTGTCAATATCAGTTATTA
TGATTACTGTTTTGATGAATGAAAAGCATGGATTCAAAGCATGCTTGGAA
AC
back to top