CF504294

Overview
NameCF504294
Unique NameCF504294
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length332
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF504294_ssr91 microsatellite CF504294_ssr91:91..100. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-783 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_F06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504294 ID=CF504294|Name=CF504294|organism=Citrus sinensis|type=EST|length=332bp
CAAAAACCCATTACAAAACAACCTCCGTTCCTTCATTTGACCCGTTCAAC
AATAATTCAGCAGATGAAGTGTTTCCATTTCAGCAACGGGGAGAGAGAGA
GGCGCGACGGCGGCGACGACGGCGGTGTCGTTTCGAGGACTTCGAAGGTA
TCATGGGCTCGTTCACTCAGTGTGGCGTCTAGTAGCGTTGACACCAGGCG
TTCGGAGTTTGACTCTGACTCCCGGGACTGGTCTGACTCGCTGGCGTTTT
ACGAGTTGTTGTCTCAGCGGAGAGCTAATGATCTGAGAGTCTTTTCGTTT
GCTGAGCTGAAATCTGCTACTAGAGGGTTCAG
back to top