CF504296

Overview
NameCF504296
Unique NameCF504296
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length466
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF504296_ssr13 microsatellite CF504296_ssr13:13..22. BLAST: Citrus ESTs to Prunus persica proteins V1
CF504296_ssr130 microsatellite CF504296_ssr130:130..139. BLAST: Citrus ESTs to Prunus persica proteins V1
CF504296_ssr141 microsatellite CF504296_ssr141:141..150. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig533 contig Csv1_Contig533:1..466. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-785 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_F08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504296 ID=CF504296|Name=CF504296|organism=Citrus sinensis|type=EST|length=466bp
CTCTCTAGAATTTCTCTCTCTCTATAAAACGACGACGTTATCATCTCAAT
ACGACACTTCCACGAAGTTATATAATCTATATATATTATTATGTTCTCTT
CTTCACCGTGAGCTCATCACTTTCTCGATTCTCTCTCTCACTCTCTCTCT
ATCTCTTTCACGTTCTAAGACGAAAACCGGGGAAGAGATTTGGATCTGTA
ATTGGCTGTAGCGGTGGATGTTAAGCCTATAAGAATCTTTGAAAGTAGAA
GAACTAACAAACACGATGAATAAGCAACTCTTGGAAATTCAACCCAAGGA
ACTGAAATTCATATTTGAATTGAAGAAGCAAAGTTCATGCTCAGTTCGAC
TGACCAATAACACCCACCATTATATTGCTTTTAAGGGTAAAACTACTTCT
CCCAAGAAGTACTGTGTGCGACCAAATGTGGGCATAATTCTGCCAAAATC
TACTTGTGACTTTAAT
back to top