CF504297

Overview
NameCF504297
Unique NameCF504297
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length348
Alignments
Feature NameTypeLocationAnalysis
CF504297_ssr239 microsatellite CF504297_ssr239:239..256.
Csv1_Contig13688 contig Csv1_Contig13688:64..411. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-786 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-16_F09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504297 ID=CF504297|Name=CF504297|organism=Citrus sinensis|type=EST|length=348bp
AGAGGAACAGTCGTTTTAAGGGAAAATGTCAGGAGTTATTCACAAGATCG
GAGAAGCCCTTCACATGGGAGGAGGGCAAAAGGAGGAGGACAAGCACAAG
GGTGAGCACCATAGTGGGGACCACCACACTACTGATGTTCACCATCAGCA
GCAGTATCACGGCGGCGAACACAAGGAGGGCTTGGTGGACAAGATCAAGC
AGCAGATCCCCGGTGTCGGTACTACTGATGTTCACCATCAGCAGCAGCAG
CAGCAGTATCACGGCGGGGAACACAGGGAGGGCGAACACAAGGAGGGCTT
GGTGGACAAGATCAAGCAGAAGATCCCCGGTGTCGGCGGCGGCGAGGG
back to top