CF831936

Overview
NameCF831936
Unique NameCF831936
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length169
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13037 contig Csv1_Contig13037:341..509. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01A17_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01A17, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF831936 ID=CF831936|Name=CF831936|organism=Citrus sinensis|type=EST|length=169bp
TACGACGTTTAAACTTCTTATGTACAAGGATGAAGCTACATGTCTCCATC
AAAAGTACGGCACATTACATGCTGGCAACAATGGAAGGAATTTCCGTTTC
CATTTCAGGCTCTCCATCTGCTCCCGCAACATTGGTCTCCAAGCCCTTCC
TTTTATGTTGAGCAAAATA
back to top