CF832082

Overview
NameCF832082
Unique NameCF832082
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length692
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7360 contig Csv1_Contig7360:534..1225. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01E13_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01E13, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832082 ID=CF832082|Name=CF832082|organism=Citrus sinensis|type=EST|length=692bp
GCCCCNCGAGTTTTTTTTTTTTTTTTATCCTTCTTAATTGTGTCTACTGA
GCACATCCTATTATTTTTAATTTTAAAATTTAGGATACAGAAATTGATAC
CAACACATACTTAAATTCAAAATACATAAATTACAAAATATTATTTTCAT
TCCCATTTTTGTTTTTAGAAAATACTAATTCAAAAACAATACCAACCACA
CGGTCAAGGTTCTGCTTTCCCTATTGTGTCCTCATCATTATCTTTCAGTG
GTCCTGGCCCGTGTTGCTGATGAGCCATATCATATGTTGCATGGAGGCCA
AAGAAAAAATAGTAAACCAGCATTACAAGAGTGCAGATTCCAAATCTTAC
AAAAGCTTGATAGCCCAGAGATCCCATGAGAAAGATATTTGTTGCAATTG
ACAAGGATGGAAGCCATGGAACTAGAGGAACTCCCCATGTTTTTGGGGTT
CTCTGCTGAGGCAGAAGCACTGATATCCCCAAAGTTCCCAAGAACCAAAG
AGGAACGGTGATAACATATCCAACCCAACCATTGGGCTTTAACCCCCAGT
AAGCTGATATTCCTGCTGAGGAAGCAATAATGATCAGGAGGAAGATTACA
AGCATCAAGAGGTTTTTTCTTGGTGTTATTTCTCGCACATAGTATCTCCT
CACAAGAAGCGCGACAGCCATCATCATGAAGACGAAGAGTGT
back to top