CF832093

Overview
NameCF832093
Unique NameCF832093
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length482
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7756 contig Csv1_Contig7756:277..758. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01E20_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01E20, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832093 ID=CF832093|Name=CF832093|organism=Citrus sinensis|type=EST|length=482bp
TTTTTTTTTTTTTTTTAGACGAGAAATGGGCTCTTTCTCATTACCTTTAA
AACTGCACGTGTAAATAACCTTGAAACAATGCTCCTACTAGGATCCGCTC
CCAACATGAACCCTAATTGGGGCAAAATTTTTCCCCGTTGATACCAAAAG
CAAAAACAAGTCACACCAATGGAACTCACCACTTTCCCAGATCCCATTTC
CGGTTAAAAGGCCAGGGACTAGGCTTCGAAACTAGAAATTCACTTAGGAT
CCCAAATGCAGGACCCCTTGTGACTCCAACAAACTCTCACCTATCTATCC
AACGTAACAGGCACTATTTTACAACAAAGCCCACTTACCCACTTAAATTA
AGAACTAGCTGCCTACAATCAAACTTTCTTAGCCAGAGCTTCTCTACATT
TGAAAGGCCATGGCGCTTTACCTATCTAACAACAGAAAACTTTTCCCCTG
TACTCTTCCTTTTATTTCTTTCTTCATTGTTT
back to top