CF832094

Overview
NameCF832094
Unique NameCF832094
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length484
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7756 contig Csv1_Contig7756:276..759. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_01E20_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01E20, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832094 ID=CF832094|Name=CF832094|organism=Citrus sinensis|type=EST|length=484bp
GAAACAATGAAGCAATAAATAAAAGGAAGAGTACAGGGGAAAAGTTTTCT
GTTGCTATATAGGTAAAGCGCCATGGCCTTTCAAATGTAGAGAAGCTCTG
GCTAAGAAAGTTTGATTGTAGGCAGCTAGTTCTTAATTTAAGTGGGTAAG
TGGGCTTTGTTGTAAAATAGTGCCTGTTACGTTGGATAGATAGGTGAGAG
TTTGTTGGAGTCACAAGGGGTCCTGCATTTGGGATCCTAAGTGAATTTCT
AGTTTCGAAGCCTAGTCCCTGGCCTTTTAACCGGAAATGGGATCTGGGAA
AGTGGTGAGTTCCATTGGTGTGACTTGTTTTTGCTTTTGGTATCAACGGG
GAAAAATTTTGCCCCAATTAGGGTTCATGTTGGGAGCGGATCCTAGTATG
AGCATTGTTTCAAGGTTATTTACACGTGCAGTTTCTGATGTAATGAGAAA
GAGCCCATTGTCTCGTCTAAAAAAAAAAAAAAAA
back to top