CF834861

Overview
NameCF834861
Unique NameCF834861
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length400
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06D24_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06D24, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834861 ID=CF834861; Name=CF834861; organism=Citrus sinensis; type=EST; length=400bp
TTAATTTTTGCATCTAAAGCTAGCAAATATCTTTTCTGACTTGAAGAATT
CCTTACTCTTCCTGGCGCAGGTATGAGCGATCCGTCAGAAGGTTACTTAC
TCCCCCCTTCCAGTATTGCTGATGCATGATGTTGGGAATGACAATCTTGA
TCTTATTGTTATTCCTCAATATGGGAGAAATCCTGATTATTATGGGTAAG
TGTCTGCAATCTGGATGATGATATATATAATTAAATAAAAAGATGGGTAC
AGTTATTATCTATCAATTATAAGAGTGTCAATTTAGTTCAGTTCACTTAC
AAAAATCTCTTATACAAGAGATTATCTTTGTTTGCGTTCATGTACTTTGT
CTTCTTTAATTAATAAATAAAACTATTGTGTATCAAAAAAAAAAAAAAAA
back to top