CF834863

Overview
NameCF834863
Unique NameCF834863
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length331
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06E02_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06E02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834863 ID=CF834863; Name=CF834863; organism=Citrus sinensis; type=EST; length=331bp
CTTTGCTGGACCCTACTTGAGGATGGAAGGACTCTTGCTGATTACAACAT
CCAGAAGGAGTCCACTCTGCATCTTGTGCTCCGACTCCGTGGAGGTTTCT
GAGTTTGGTCATCTGGGTGTGTGTGTGTCTTATTTGCTTCGGTTTGTCTT
GGTTAATGTTTGCTGGCTATTGGTGAAATAGCTTAAATAACTATTTGAAG
TTTATTTTGGTTTGTGGTAGTTGAACTCTGTTTCTAAGATATTGATATGG
TCCCACTAACGTCCCATTATAATATCTAAGAATCTTTTTCTTGAATAAAT
ACATGTTTAATGTGCAAAAAAAAAAAAAAAA
back to top