CF834873

Overview
NameCF834873
Unique NameCF834873
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length429
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06E08_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06E08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834873 ID=CF834873; Name=CF834873; organism=Citrus sinensis; type=EST; length=429bp
TTTTTTTTTTTTTTTTTGTTGACCACACAATAACTTTTATTGATTTACTC
TTTTTTTTCAAGAAAATACTTAGCTCAAAAAGATATCTTGCTACATCTCA
AGAAATCTCATAAGTTGAACTAAACCAGACTAAGACATTGCCATGATTGA
TAGGTAATAGTATACCTATCATTTATTTAATTAAACAAAACAGAAAAAAA
AAAAAAGCAGTGCTGCACTTAACCCATGTAGTCGGGGTTTCTTCCATATT
GAGGGACATTAAGAAAATCAAGATTGTGGTTCATGACATCATCATCAGCA
ATACTGTTCCAAACATTAAACCAACCCTCTGACCAGTTATTACCTGCGCA
GGGGGTTTCCATGTTCTTCAAATCAGAAAGATCTCTGCTTACGGGAATCA
AAGTTCGAAAGTAGTTAAGTTGCTTTTTC
back to top