CF835093

Overview
NameCF835093
Unique NameCF835093
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length228
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06K14_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06K14, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835093 ID=CF835093; Name=CF835093; organism=Citrus sinensis; type=EST; length=228bp
GCTGCTTGATAGTACTGATTTCGCGTTCTAGAGATATATAATTATATTTT
ATTACTATTTGTATTTGAGCTCATTTGAACCTTGTTGGTTTCTTGTGGCA
CTAGGTTGTAGGTCATATTTGGTTGTGTTTATATGTAAAACTTGTTCATT
TCAAACAATGTGTATTTCTCAACTTATTATCTGTAAAATCTCATTTCAAT
TCACAACTCCTGAAAAAAAAAAAAAAAA
back to top