CF835310

Overview
NameCF835310
Unique NameCF835310
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length190
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6690 contig Csv1_Contig6690:680..869. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_01A12_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01A12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835310 ID=CF835310|Name=CF835310|organism=Citrus sinensis|type=EST|length=190bp
CCCCTTTTTTTTTTTACATAAAACAGTAGTCTATTCTATATTCTACAAAC
GTTCACTGAAAGCCATTGAAGCAGAAGCAAACATAGGTCTTAGATTCTAT
ATTAGTTCTTATTTAAAAAAGATCCACTATATATGCTTTTAAACAGGCAG
NCTGGTTAATTAATTCCACTAGGCCGCNATGGCGCATCTG
back to top