CF835386

Overview
NameCF835386
Unique NameCF835386
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length588
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CF835386_ssr134 microsatellite CF835386_ssr134:134..145.
Csv1_Contig11492 contig Csv1_Contig11492:20..606. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS03_01C12_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01C12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835386 ID=CF835386|Name=CF835386|organism=Citrus sinensis|type=EST|length=588bp
CTCATTTATTCCCTTTACTTCTTTTATATAAAAGAAGTATTATTTTTGTG
CCCTAGCAGCTTACATTGCACTTACAAAACAAAGAAAAAAGGAAAAACAG
AATGAAGCTTACATCGCATAAATGTAAGCAAGATTATTTATTTATTGAGA
TACAAATACAAATTTATTATGGAGCTTCAGTTTTGAGGCTCGGTTTCAGG
CTCAATATCAACAGCCTCACCAGCGTAAGTGCAGCACCTGCAGCCTCTTC
CATAATAACCACGTCCACAGCAACCGTAGGGGCAGTGGCCACCGCCATGG
CCACCGCCATGGCCACCACCATGGCCCCCGCCATGGCCCCCACCACCGCC
ATAGCCCCCACCACCGCCATAGCCCCCACCACCGCCGCCGTATCCGCCGC
GACCGTCCTCAATTTCATGTGTCTCTGTGGCCTTATCAGCCTTTTCGTTG
TGATCAATGGAAGACTCGGCCAGGTCTCTGGCTGCTACCTCGGAAGAGAT
AAGAAGAGCAATGGCCATTAAAAGGCCTAAAAGAAGGAACAATTTGGAAC
CCATTTTTCTTTTTCTTGCTTGAGAAAACTATCAATGA
back to top