CF835705

Overview
NameCF835705
Unique NameCF835705
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length728
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CF835705_ssr175 microsatellite CF835705_ssr175:175..192.
CF835705_ssr274 microsatellite CF835705_ssr274:274..285.
CF835705_ssr306 microsatellite CF835705_ssr306:306..317.
Csv1_Contig385 contig Csv1_Contig385:188..914. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUCRCS03_01L23_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01L23, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835705 ID=CF835705|Name=CF835705|organism=Citrus sinensis|type=EST|length=728bp
TTTTTTTTTTTTTTTTTATCATATAATTGATAATGGAAATTCACCTTGAC
AAAAGGCAAATTACACACTGACTGGGCAGAATAAAAAACAGTCTCTCTCA
AAAGCAATAATTTAAACACTAACACCACCTTAAGGAGACACCCCAAAAAT
AAAGCAGCAAGCTCTTACTGTGACCACACACACACACACACACCAAACTT
TTATTATAGAATAAATCTAAGATGATGGATGATGGATGCGTCACATAAAA
GTTAATTAATTTAATCGCTGTCACTGCTGCTGCTGCTCTCGTGTCCGTCC
TCGTGCTTCTTCTTCTTCTCCTTCTTTTTCTTCTTCTCTTCACCGTGGGC
GGCGCCCTCGCCGCCGCCGACACCGGGGATCTTCTGCTTGATCTTGTCCA
CCAAGCCCTCCTTGTGTTCGCCCTCCTTGTGTTCCCCGCCGTGATGCTGC
TGCTGATGGTGAACATCAGTAGTGCCGACACCGGGGATCTGCTGCTTGAT
CTTGTCCACCAAGCCCTCCTTGTGTTCGCCGCCGTGATACTGCTGCTGAT
GGTGGACATCAGTAGTGTGGTGGTCCCCACTATGGTGCTCTCCCTTGTGC
TTGTCCTCCTCCTTTTGCCCTCCTCCCATGTGAAGGGCTTCTCCGATCTT
GTGAATAACTCCTGACATTTTCCCTTAAAATGACTCTGTTCCTCTTCTTT
TCTTTTCAATGAAAAATAGTTGTTTGCG
back to top