CF835707

Overview
NameCF835707
Unique NameCF835707
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length607
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5534 contig Csv1_Contig5534:5..611. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS03_01L24_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01L24, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835707 ID=CF835707|Name=CF835707|organism=Citrus sinensis|type=EST|length=607bp
TTTCTTTGTCTTTTCTTCTTTTGCCTGAAAAATGGGTTCTAAAGTTTTCC
TTATGTTAGGTCTTTTAGTGTCTATTGTTCTTCTCATCTCTTCAGAGGCG
GCAGCTAGAGATCTTGCTGAGACTTCTAATGATGATCAGAAAAATGGTGA
GGTAGCTGGAGAGACTAATGGAGTAGATGATGCCAAGTATAATGGTGGAT
ATGGAGGGTACCCAGGCGGCGGCCGCGGTGGCTATGGTGGATACCCAGGT
GGCGGCCGTGGTGGCTACGGAGGATATCCTGGACGTGGTGGCTATGGCGG
AGGTGGCCGTGGTCATGGTGGAGGATATTGCCGCTACGGTTGCTGTGGCC
GTGGCTATTATGGGAGAGGTTGCAGGTGTTGTTCCTATGCCGGTGAGGCG
GTCAATGCCCAAACTGAGGCTGAACCTCAGAACTAAAGCACGATATATAA
CTGCCTCGCTTCAGTTGCTTCCTTGCATGCACCGTGTGCAAGTCCTACGT
ATAATAAATCAAGAGATGCTTAATGCATCATAAGAAAGAAATAAATCAAC
CTTGAATGGTCTGTGATCCTACTTATGATATCAATTTAATTAAAAAAAAA
AAAAAAA
back to top