CF835717

Overview
NameCF835717
Unique NameCF835717
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length387
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:444..830. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS03_01M05_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01M05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835717 ID=CF835717|Name=CF835717|organism=Citrus sinensis|type=EST|length=387bp
CTCGAAGCTAGCCATATCTTTTCTGACTTGAAGAATATGAAAACTCTTCC
TGGCGCAGGTATGAGCGATCCGTCAGAAGGTTACTTACTCCCCCCTTCCA
GTATTGCTGATGATGATGTTGGGAATGACAATCTTGATCTTATTGTTATT
CCTCAATATGGGAGAAATCCTGATTATTATGGGTAAGTGTCTGCAATCTG
GATGATGATATATATAATTAAATAAAAAGATGGGTACAGTTATTATCTAT
CAATTATAAGAGTGTCAATTTAGTTCAGTTCACTTACAAAAATCTCTTAT
ACAAGAGATTATCTTTGTTTGCGTTCATGTACTTTGTCTTCTTTAATTAA
TAAATAAAACTATTGTGTATCAAAAAAAAAAAAAAAA
back to top