CF835728

Overview
NameCF835728
Unique NameCF835728
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length411
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:163..573. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS03_01M12_f Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa01M12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835728 ID=CF835728|Name=CF835728|organism=Citrus sinensis|type=EST|length=411bp
TTTTTTTTTTTTTTTTTCGCCATCACAAAAACTTTTATTGATTTATTTCC
TTTTTCCGGAAAATACTTAGCTCAAAAGTAAACAAAAAGATTGCTTGTAC
GTCTCCAGAAATCTTATAAGTTGAACTAAACCCTACTAAAACCTTGTCAT
GATTGATAGGGAATAGGATACCCATCCTTTATTTAATTAAACAAAACAGA
AAAAAAAAAAAGCGGGGCTGCACTTAACCCATGGAGTCGGGGGTTCTTCC
ATATTGGGGGACATTAAAAAAATCAAGATTGGCGTTCATGAAATCATCAT
CAGCAATACTGCCAAACGGAGGAAGCAAAAAACCCTCTGACCAGTTATTA
CCTGCGCAGGGGGGTTCCATGTTCTTCAAATCAGAAAAATCTCTGCTTAC
GGGAATCAAAG
back to top