CF835912

Overview
NameCF835912
Unique NameCF835912
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length437
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:136..572. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02B18_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02B18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835912 ID=CF835912|Name=CF835912|organism=Citrus sinensis|type=EST|length=437bp
GAAAAAGCAACTCTATCTACTTTCGAACTTTGATTCCCGTAAGCAGAGAT
CTTTCTGATTTGAAGAACATGGAAACCACCTGCGCAGGTAATAACTGGTC
AGAGGGTCTTCTGCTTCCTCCGTTTGGCAGTATTGCTGATGATGATGTCA
TGAACGACAATCTTGATTTTCTTAATGTCCCCCAATATGGAAGAAACCCC
GACTACATGGGTTAAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTT
AATTAAATAAATGATAGGTATACTATTACCTATCAATCATGACAATGTTT
TAGTATGGTTTAGTTCAACTTATAAGATTTCTTGAGACGTACAAGCAATC
TTTTTGTTTACTTTTGAGCTAAGTATTTTCCTGAAAAAGGAAATAAATCA
ATAAAAGTTATTGTGTGTGTCAAAAAAAAAAAAAAAA
back to top