CF835919

Overview
NameCF835919
Unique NameCF835919
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length402
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5486 contig Csv1_Contig5486:495..896. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Shoot Meristem cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS03_02B24_r Washington Navel Orange Shoot Meristem cDNA Library Citrus sinensis cDNA clone CS_PEa02B24, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835919 ID=CF835919|Name=CF835919|organism=Citrus sinensis|type=EST|length=402bp
GACGGCTGAAAAGGCAAGAGAGAAGACTCTTTCTGACCAGTTTGAGGCTA
AGCGCGCCAAGAACAAGGCCAGCAGGGAGAGAAAGCTGGCCAGGAGAGAA
GAGCGACTAGCACAGGGACCTGGAGAGAAGGCAGTACCAGCACCCCAACC
AGCTGAGGGAGCTAAGAAAGCTAAGAAGTGATCGCTGATACATCGATGAT
GGAGACTGAAGATTGATAACTTATATATGTTAATGTTGGTTCTGGTTTCT
TTGTAGGAGTTTGTTTCCCAAGTTATTTTGTTTTCTGTTTAATGGCAAAT
TATTTACTTATAAAGCCTTGAATTTTGGAACCATATGAACCGTTTGTAGT
TTCTTGTTATGTTGAATGATGAGTATTATGTTCATTAAAAAAAAAAAAAA
AA
back to top