CK740112

Overview
NameCK740112
Unique NameCK740112
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length381
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6606 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE65E11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740112 ID=CK740112|Name=CK740112|organism=Citrus sinensis|type=EST|length=381bp
ATTCAGGCAGGGCAACGTCGCGGCTTGCACTTCACAATAGCACCAGGACC
AGCCGTGACACCCCATCAGGAGCCGCTCCAATAATTGTTTTTTCTGATTA
CATAACCTTGTTGGTGAAACAGGCAGGCTAGAGAATAATTGAGTTTATTG
CGTTGCTGGAACAAGTGGTGGGGAGAGGAAAATGGGAAGGCTGTATTTTG
TCTCAAGCTTAGTTATATGTTATATAAACCCTGCAAGCTCTTTCCTTCTT
TTGTTTTAATTTTTTTTTTCCCCTCTTTTTCTAACTACCCAATTTCTCTT
GTTATATTTGTACATAAATTTTTATGAAATCACCGCGGCTATTTGCTGCT
GGACTTGCGATTCTAAAAAAAAAAAAAAAAA
back to top