CK740115

Overview
NameCK740115
Unique NameCK740115
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length639
Alignments
Feature NameTypeLocationAnalysis
CK740115_ssr618 microsatellite CK740115_ssr618:618..637.
CK740115_ssr246 microsatellite CK740115_ssr246:246..257.
Csv1_Contig13325 contig Csv1_Contig13325:321..958. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6609 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE65F03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740115 ID=CK740115|Name=CK740115|organism=Citrus sinensis|type=EST|length=639bp
CTACAACAACCCTAACAAGTACAACTTCAATAACAACAGATACTATTACA
ACAACAACGGTTTTCAGACAGAGCAAGAGAGGTTGGGTGACTCGAAATTC
CAAGAAAGTGGCTACAGAAGCAACCAGAACAGTTACAACAACAATAATGC
TGAGAAGAAAGGGATGAGTGACACCGAGGTTTTTGGAGAATGGCAAGTAC
TATTACGACGTCAACAACGAGAAAAATTACAATCCAAACCAGTACCAGCA
GCAGCAGAATTCGAGGGGTTACTACAATGAGAACACTTACGAGTACAATA
ACAATAACTTCCAGAATGAAGAGAACGAGTTTGATGAACTCCCCTGAACA
TGATGCCTCTAGCCGGTCTACAATTATGTGCGTGGTGTTGATCAGATGCT
AAGTTATGTTTAATTAATAGGAAAGAGTAAGCAAATAGATTTATTTTATT
ATATCTGGGCTTTCTTGGTGGTCATTTTGTTATCGTGTACTTTCGGGGGT
TGCATAGTCTCATCACTCATGCTGCTTTGAAAAAGCTAAGGGATGAAATT
TATAAGCTTGGTTTGGCTTTGGTTATGAACATTGAAAATTAATTAATAAA
GGGGATACTTTTACTTAATATATATATATATATATATCT
back to top