CK740117

Overview
NameCK740117
Unique NameCK740117
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length500
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4944 contig Csv1_Contig4944:563..1060. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6611 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE65F04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740117 ID=CK740117|Name=CK740117|organism=Citrus sinensis|type=EST|length=500bp
GTCTTTGACAAGCCCACACATCCTAACTCTCCCACTGTTTATGACTGGCT
TTACAGTGGGGAGACTAGGAGCAAGCATCATCACTAGTGGATGATACGCC
TACAGCGATGTAAATGAATGTGATGGGTCACCAACTCACCGGATGAGTTG
CCTGTAGTCTGTAGATAGTGTCGTTTCGTTTTGGATTTCGCAACGTGTCC
TTGTCGTTTTGTTAATGCTATTTGTATTACGTGTCCTTCCTATCTAAAGT
TTGGTTTTAAAATGCTGCTGACTAAAAGTAAATTAAAGACTGTGATGTTT
TTATATCATATAATTTAATAATTGTATGTGATGTGAGGATTGCTAAGCTG
TGGGCGGAGATGAAAGGGTGCTGGTTTTTGGGTTTAGGACATGTTTTTTG
ATTGTCATTTTGTAAGAGCCAAGATCATCCCTTCGTGGACGGTCGTGATG
AGCATATATGTTTTATTATTAATAAATAAGTTGCTTCTCTGAAAAAAAAA
back to top