CK740332

Overview
NameCK740332
Unique NameCK740332
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length317
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9206 contig Csv1_Contig9206:25..341. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_6659 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone RSE66D02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK740332 ID=CK740332|Name=CK740332|organism=Citrus sinensis|type=EST|length=317bp
TTATGGTAGCCCAGAAAGGAAGTATGCTCGTGGTTCTAGATGATGATGCT
GTTTGTTAGGATTTGATACCACTGTTGAGAGGTTTGATAACAGGTGTGAA
ATCCTGTTGTGGTGATGTAATGTATTTGGCTTCAACTACGGTTAAGCAGA
TGTCTGGGCTTGATCAGGTTTCGGGATACAGTTGCTTTTCAAGTGTCTTG
CTTCTTTTATTAGTGCTTGTCATCATGTACCTGTTATTTTAAACTTTATA
TTCATAATGCTTGTGGTTAGTAATATTGCATCTCAACTTTGGCTTACTCA
AAAAAAAAAAAAAAAAA
back to top