CK935198

Overview
NameCK935198
Unique NameCK935198
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length136
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004564_G10 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0001_IIIF_G10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935198 ID=CK935198|Name=CK935198|organism=Citrus sinensis|type=EST|length=136bp
GGGGACGGAGATGTGTGTACGAAAGCTACACACCCTTTGTCTTTGTCTTC
TTCATCTCATAAATCTCTTACTCGACCGACATGACAACAATATTCACCTG
AACTGAGCGAAGGGAGAGACCCAAAAAAAAAAAAAA
back to top