CK935216

Overview
NameCK935216
Unique NameCK935216
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length516
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004564_D09 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0001_IIIF_D09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935216 ID=CK935216|Name=CK935216|organism=Citrus sinensis|type=EST|length=516bp
GGGGACTATCATTCGAAGAAGCATCGTCACAATCATTTGAAATTCTATAA
TCTCAGTTTCAATGAAGACGAAGAGGCTTGGTTTAAATATCGGCTTTCAT
CATGCATTTTCAGGTTTAATTTCAGTTAATCTGACCAAATTTGATGGATT
TGTTCCCTAATTTCATGAATGTCAGCTCTCACTTTCATTCGATCGAAGAA
GCTTTCACTTTCGTTTGAAATTTTTGATCTCGATCGGTTTCACTGCAAAG
GAAGAGTTAGAGGTGCCTCAAAAGCAATTACTTGTGGCATGTGGGGACTG
TCATCTCCTTTGGATGTACTCATCATTGTATATGGTGTAAATGATGTGCC
TATATTGTACTTAGATGGTATTATGAGCAAATTGCTAGTGCTACTTCAGA
ATGGAAAACAAATAGTGCAAGAAGGTGTATTAATTGCCTTGGCATCAGTA
GCTGACTCATCTCAGCTACTCGGATGGAAACTTCTTTAAAAAAAAAAAAA
AAAAAAAAAAAAAAAA
back to top