CK935429

Overview
NameCK935429
Unique NameCK935429
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length883
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3744 contig Csv1_Contig3744:1..871. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004555_G02 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0004_IVF_G02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935429 ID=CK935429|Name=CK935429|organism=Citrus sinensis|type=EST|length=883bp
GGGGGGCCTCTCCAGACGTTCCTATTTCTGTCAGCCTCGTTATCAACTTC
TTCGCCGGAGTCATGGCTCCTATTTACAGTTTTCCCATCCTCTTCCTATT
CTGTTCTACTCTTATCTCTCCCACTCTTTCCACTACGAGAAAACTCAACG
CTTTAGTTCAAGAACAACCGCTCGTCCTGAAATACCACAACGGCGCTCTT
CTAAAAGGCAACGTCACCGTTAATCTCATCTGGTACGGCAAGTTCACTCC
CATCCAACGCTCGATAATAGTTGACTTCATCCACTCCCTAAATTTCAACA
GGGCCCCGCAGCCCTCCACGTCATCGTGGTGGAAAACAACTGAAAATTAC
AAAGGAGGTTCGTCTAACCTCGTCGTACGGCATCAAGTCCTCTTGGAAAA
CTACTCCCTTGGCAAAGCACTGAAAAAGGTTCATTTGCTTGCTTTGTCCA
AGAAAGTAACGAACACTCTCCCTACGTCAATTAACGTCGTTTTGACGGCG
AAGGATGTGGCCGTGGACGGCTTCTGCATGAACAGGTGTGGGACCCACGG
GTCTGCTCTGCCGGGTCGTGGGTTGGCCAGCCGTGGAACCTATATCTGGG
TTGGAAACTCCGAGACTCAGTGCCCTGGCTACTGTGCCTGGCCTTTCCAC
CAGCCCATTTACGGCCCTCAAACCCCGCCATTAGTCGCGCCTAACGGAGA
CGTCGGCGTTGATGGAATGATTATCAATTTAGCTACCCTTTTGGCCAACA
CCGTCACTAACCCGTTCAATAACGGGTATTTCCAAGGCCCGCCAACGGCG
CCGATTGAGGCGGCCACGGCATGTACGGGTGTGTTTGGGTCAGGTTCTTA
TCGGGGATATCCGGGTCGGGTCTTGGTGGATAA
back to top