CK935511

Overview
NameCK935511
Unique NameCK935511
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length952
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3452 contig Csv1_Contig3452:557..1508. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004554_H05 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0004_IIIF_H05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935511 ID=CK935511|Name=CK935511|organism=Citrus sinensis|type=EST|length=952bp
GGGGAGGAAGCAAACAGCAGATATGCTAAAGCGCATGCAAACATTAGTCA
AAGTGCAGGCACGGGTCCGTGCTAGTCGCACTCCCACGTCAGAATCTTTG
CTTTCTAGCAGCAAATCATCTCTTTCTCGCAGTACGAGATGTGGTTCCAG
TTCGAACTTTGGAGATATCACTGACCTAGACAAAGGACGGTTGGGTTCAA
ATTGGTTAGATCGTTGGATGGAAGAAAGTGTATGGAACGGCCATAGAGTA
AGTCAACTTAAAAGTGGACCTCCTGCAGATGATGAGAAGAGTGACAAGAT
CTTGGAAGTAGATACATGGAAGCCTCACTTGAACCCCCGACAACATAATA
GAGTCATTCGATCCTCACCGCATGGTTCTGCTTTGGATTATAACAATCAC
AGCTACATGACAATCGACTCTCCATCAAAATTATCAGTAAAAAATATGAA
TCCAATCCCAAGTGTATCTCCAGGGGAGGTTTTATCATTGAGCTCACTGA
AAGCTCCGGTGGGAAAAAGTGATGCAGCTTTGAGGACTGCTGATAACAGC
CCGCAAGTATCATCTGCATCATATAGACCTGGAAGTAGTGCAAGAAGAGG
CCCTTTCACGCCCACAAGAAGTGAGTATTCATGGGGCTACTTTAGTGGAT
GCATAGGCCACCCAAATTATATGGCTAACACGGAATCATCACGAGCGAAG
GTCAGATCACTGAGCGCCCCAAGGCAAAGACTTGAGCTCGAGAGATATGG
TTCAACCAAGAGGTCAGCTCACGGGTTTTGGGATGGTAGCATTAATTCCG
AAAGAGATTTTGCTCAACATGCTGACTTCAGGAACAGAGCTTCTCCAACA
TCTGACCGGTTGAGTAAATTCGGGAGCATAAATTTAAGGTGATGCTGCAC
GTTTGCTTTCATTTTTCACNNNNGTAAGTTTCGCTTTCGCTTTCCAAGTG
TA
back to top