CK935522

Overview
NameCK935522
Unique NameCK935522
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length776
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of CK935522 vs. ExPASy Swiss-Prot
Match: SDG40_ARATH (Protein SET DOMAIN GROUP 40 OS=Arabidopsis thaliana GN=SDG40 PE=2 SV=1)

HSP 1 Score: 266.544 bits (680), Expect = 1.121e-70
Identity = 141/254 (55.51%), Postives = 171/254 (67.32%), Query Frame = 2
Query:    5 ASATVSSRTMHISWDEAGCLCPVGDLFNYAAPGEGEESNIGIEDAEGWMPAPCLPKGDTTDVLDSEKFNAHLHRLTDGRFEEDVNSYCFYARNNYKRGEQVLLSYGTYTNLELLEHYGFLLNENPNDKVFISLEPGMYS-CCSWPRESQYVDQNGKPSFSLLSALRLWMTPVNQR-RSVGHLAYSGHQLSVDNEISVMKWLSNNCLGMLNSLPTSKEEDALLLCAIDKIQDIYTAMELKKVLSDFGGEVCTFLE 760
            ASAT+SSRT+H+ WD AGCLCPVGDLFNY APG+   +  G E A     A  + +              H  RLTDG FEEDVN+YC YAR NY+ GEQVLL YGTYTNLELLEHYGF+L EN NDKVFI LE  ++S   SWP++S Y+ Q+GK SF+L+S LRLW+ P +QR +SV  L Y+G Q+SV NEI VMKW+S  C  +L  LPTS  ED +LL  IDK+QD    +E K+    FG EV  FL+
Sbjct:  186 ASATISSRTLHVPWDSAGCLCPVGDLFNYDAPGDYSNTPQGPESANNVEEAGLVVE-------------THSERLTDGGFEEDVNAYCLYARRNYQLGEQVLLCYGTYTNLELLEHYGFMLEENSNDKVFIPLETSLFSLASSWPKDSLYIHQDGKLSFALISTLRLWLIPQSQRDKSVMRLVYAGSQISVKNEILVMKWMSEKCGSVLRDLPTSVTEDTVLLHNIDKLQDPELRLEQKET-EAFGSEVRAFLD 425          
The following BLAST results are available for this feature:
BLAST of CK935522 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
SDG40_ARATH1.121e-7055.51Protein SET DOMAIN GROUP 40 OS=Arabidopsis thalian... [more]
back to top
Libraries
Library NameType
Developing fruit 24 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004554_G10 Developing fruit 24 DAFB Citrus sinensis cDNA clone T24DAB0004_IIIF_G10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK935522 ID=CK935522|Name=CK935522|organism=Citrus sinensis|type=EST|length=776bp
GGGGGCTTCCGCAACTGTTTCCTCTCGGACAATGCATATATCATGGGATG
AAGCTGGGTGTTTATGTCCTGTGGGAGATTTATTTAACTATGCTGCACCT
GGAGAGGGAGAAGAGTCAAATATTGGCATTGAAGATGCTGAAGGTTGGAT
GCCTGCCCCATGTTTGCCAAAGGGGGATACTACAGATGTCTTAGATTCTG
AGAAATTCAATGCTCATCTGCATAGGTTAACGGATGGTAGATTTGAGGAA
GATGTTAATTCCTACTGTTTTTATGCTAGGAACAACTATAAGAGGGGAGA
ACAGGTTCTATTAAGTTATGGAACTTACACAAATTTGGAGCTCCTTGAAC
ACTATGGGTTTCTTTTAAATGAGAATCCAAATGACAAGGTTTTTATATCC
TTGGAACCTGGCATGTATTCCTGTTGTTCGTGGCCCCGTGAATCACAATA
CGTTGACCAAAATGGTAAGCCATCGTTTTCTCTCCTCTCTGCTTTGCGGT
TATGGATGACACCAGTGAACCAGCGGAGGTCAGTTGGGCACCTTGCTTAT
TCAGGACATCAACTTTCGGTGGACAACGAGATATCTGTCATGAAATGGTT
ATCAAACAACTGTCTTGGTATGCTGAACAGTTTGCCGACATCAAAAGAGG
AAGATGCCTTATTGCTGTGTGCCATTGATAAAATCCAAGACATCTATACC
GCAATGGAACTGAAAAAGGTTCTGTCAGATTTTGGAGGTGAGGTCTGTAC
ATTCTTAGAAAACTACGATGTGCAAT
back to top