EY756571

Overview
NameEY756571
Unique NameEY756571
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length337
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:248..583. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-010-B04-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756571 ID=EY756571|Name=EY756571|organism=Citrus sinensis|type=EST|length=337bp
TTCGTCGACCCACGCGTCCGATTGCTGATTATCATGTCATGAACGACAAT
CTTGATTTTCTTAATGTCCCCCAATATGGAAGAAACCCCGACTACATGGG
TTAAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAA
TGATAGGTATACTATTACCTATCAATCATGACAATGTTTTAGTATGGTTT
AGTTCAACTTATAAGATTTCTTGAGACGTACAAGCAATCTTTTTGTTTAC
TTTTGAGCTAAGTATTTTCCTGAAAAAGGAAATAAATCAATAAAAGTTAT
TGTGTGTGTCNAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top