EY756520

Overview
NameEY756520
Unique NameEY756520
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length446
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13815 contig Csv1_Contig13815:9..454. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-E10-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756520 ID=EY756520|Name=EY756520|organism=Citrus sinensis|type=EST|length=446bp
CCACGCGTCCGAACTTAACTACTTTCGAACTTTGATTCCCGTAAGCAGAG
ATCTTTCTGATTTGAAGAACATGGAAACCACCTGCGCAGGTAATAACTGG
TCAGAGGGTTGGTTTAATGTTTGGAACAGTATTGCTGATGATGATGTCAT
GAACCACAATCTTGATTTTCTTAATGTCCCTCAATATGGAAGAAACCCCG
ACTACATGGGTTAAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTA
ATTAAATAAATGATAGGTATACTATTACCTATCAATCATGGCAATGTCTT
AGTCTGGTTTAGTTCAACTTATGAGATTTCTTGAGATGGACAAGATATCT
TTTTGAGCTAAGTATTTTCTTGAAAAACGAAATAAATCAATAAAAGTTAT
TGTGTGTGTCGAANAACCATCAGTTGTTGCTAACCAAATGCGAAAA
back to top