EY756510

Overview
NameEY756510
Unique NameEY756510
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length909
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY756510_ssr540 microsatellite EY756510_ssr540:540..557. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-D11-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756510 ID=EY756510|Name=EY756510|organism=Citrus sinensis|type=EST|length=909bp
CCACGCGTCCGAATCCAAATGGGCTTTTATATTCTCTTAATCGCGTCAGA
TCCGCGTGGTGTGACACTATAAAAGCACACGTACTCTGTGTCTTAAGTAA
GCAAAAATTCCTTAAAGAAGCCCGAAAACTTACTTTATTGCACATACCAC
ATATCTCTGTGTTCTTGTCCGTTGATCTGTTGTTAAAAATTGTTGTTTGT
GAGTGATAATTGACAAGTATGGCTGAAGAGATCAAGAAGCAGCAGAAGAG
CCATGAGTACGAGCCGAGTGTTGGGACGGAAGGTGCAGTGGAGACCAAGG
ATCGCGGGATGCTTGATTTCTTGGGGAAGAAAGAAGAGGAGAAACCTCAA
CATCACGATCAGGAGGTGATCGCCACCGAGTTTGAGAAAGTTCATGTCTC
TGAGCCTCAGCCAAAGGTAGAGGAACACAGGAAGGAGGAGAAAGAGGAAG
AGAAGAAGCCCGGTTTCTTAGACAAACTTCACCGATCCACCAGCAGCTCT
AGCTCTTCAAGCGATGAGGAGGAGGGCGATGATGAGGAAAAGAAGAAGAA
GAAGAAGGAAAAGAAGGGACTGAAGGAGAAGCTCAAGGAGAAAATATCAG
GTGAGAAAGAAGAGGACACGACAGTCCCTGTCGAGAAACTTGATGATGTC
CATGCTCCCCACCACCAGGAAAGAGCCCATCCTGAAGAAAAGAAAGGATT
TNNCTCACAGATCANGGAGAAACTACCAGGACAGCAAAAGAAACCCTGAG
ATCATCAGGTCCCTTCTCCCTCTGCTGCTGAGCACCCCACATCANTCGAG
GCTCCCTGAGCAGAAGCCAAGAGAAGAAAGGCATATTGGAGAAACTCAGG
GAGAAGCTCCCTGGCTACACCCAAAGTGCTGAGACGAAAAGGATTAGGAC
AANGAACTG
back to top