EY756508

Overview
NameEY756508
Unique NameEY756508
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length893
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY756508_ssr161 microsatellite EY756508_ssr161:161..175. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig13448 contig Csv1_Contig13448:529..1425. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-D09-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756508 ID=EY756508|Name=EY756508|organism=Citrus sinensis|type=EST|length=893bp
CCACGCGTCCGGTACATTTTCTCATCTGTTGACAGTTATTTACATGGCAA
AAAAAAAAAAAAAAAAAAAAATATTATCCTCATAAATCCAAACTGCAAAC
AATCAGAACCAAGGTGGCAAGAATGGTAAAAATGGTGGAGGGCAAAATGG
AAATAATGGAGGCGGCGGCGGCGGCGGAGCTAATAACAAGAATGGTAATA
ATGGCGGTGGGGCAAACGGTCATAATATGAATGGTAACGGGGGCAAAAAG
GGCAATGGTGGTCCAAATCCAATGGGTGATATGAATGGTGGGTTTCAAAA
CATGGGTGGCGCTGCCGCTGCTATGGCTGCTGCTAATGCCAAGATGGGTC
AAATGCCAATGGGCCAAATGGGTAGTATGCCAATGGGCCAAATGGGCAAT
GTTCCAGCTGTTCAAGGCCTACCAGCAGCTGCAATGAACGGTGGTGCCGG
TGGAGGTGCCGGGTACTTTCAAGGTGCCGGCCCGGACCTTATGCCGGGTA
ACCCATACCATCAGCAACAGCAACAACAGTACATGGCTGCTGCAATGATG
AACCAACAACGTGCAATCGGTAACGAAAGGTTTCAGCCCATGATGTATGC
AAGGCCTCCACCTGCTGTTAATTACATGCCCCAACATCCATACCCGCCAT
ATCCATACCCGCAGCACCCATACCCGCCCCAGGATCCCGGATATACTCAC
TTCTTCAGTGATGAGAACACCCTCANNGTGCATGTGATGTGAAAATATGT
CCCCACTTCGCTAGGGTTTGTGACTGTAGNTCAGNTCCGGTGTCGGGGGT
GGCCCATTATAGNTCGAAGACTAAAAAAGTTGTCATGCCATATTATACAT
CATGGAAGGGGTTTTTATTTAGTTTTAAAATTTTCCCTCCTTT
back to top