EY756473

Overview
NameEY756473
Unique NameEY756473
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length527
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
EY756473_ssr349 microsatellite EY756473_ssr349:349..360.
Csv1_Contig11492 contig Csv1_Contig11492:114..640. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-009-A04-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756473 ID=EY756473|Name=EY756473|organism=Citrus sinensis|type=EST|length=527bp
CCACGCGTCCGAGCCAGAGACCTGGCCGAGACTTCCATTGATCACAACGA
AAAGGCTGATAAGGCCACAGAGACACATGAAATTGAGGACGGTCGCGGCG
GATACGGCGGCGGTGGTGGGGGCTATGGCGGTGGTGGGGGCTATGGCGGT
GGTGGGGGCCATGGCGGGGGCCATGGTGGTGGCCATGGCGGTGGCCATGG
CGGTGGCCACTGCCCCTACGGTTGCTGTGGACGTGGTTATTATGGAAGAG
GCTGCAGGTGCTGCACTTACGCTGGTGAGGCTGTTGATACTGAGCCTGAA
ACCGAGCCTCAAAACTGAAGCTCCATAATAAATTTGTATCTGTATCTCAA
TAAATAAATAATCTTGCTTACATTTATGCGATGTAAGCTTCATTCTGTTT
TTCCTTTTTTCTTTGNTTTGTAAGNGCAATGTAAGCTGCTTGTTCACAAA
AATAATACTTCTTTTATATAAAAGAAGTATTTATGAATAAATGAGTACAT
TTTTAGAGCTTTAAAAAAAAAAAAAAA
back to top