EY756173

Overview
NameEY756173
Unique NameEY756173
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length278
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-005-E04-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756173 ID=EY756173|Name=EY756173|organism=Citrus sinensis|type=EST|length=278bp
CCACGCGTCCGAGCCGCTTAGGGCTTGCTAAGATAATGTATCGGCCGAGG
CAGGGTTTGGTTTATCGGGTTTGATCCCGATATAAATTTATATATCGTCA
ATATATATTTATATGTTTGCGTAACTATTTAACATTTTCCACAAAGGGTA
CTATTATATTTTTGTTTTGTTTAGATTTACATTGTATCCTAGTCATTACG
TTATTTGATAATGAACATGAGGTACAATGCTTCTTTTCNAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top