EY756167

Overview
NameEY756167
Unique NameEY756167
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length844
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-005-D10-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756167 ID=EY756167|Name=EY756167|organism=Citrus sinensis|type=EST|length=844bp
CCACGCGTCCGTCAAGAGGATCCCATGCAGATGCTCTAAAGAAGAGCATA
GATGTGTACCCAATAAAGAGAGATGCCTAACACGCCCTGGTAAATATGGT
GAAAGGTCAGGGTCCTTCTTTCAATGGAACAGTCAATTCAGTTTCCCGCT
TCAATCAACCTAATAAGTGTGCATCCACTGGAGTGTAAAGCAAGGAAGTA
AATACAAATGGAGTTTCTGTAAGACCGACTACTGTGGCATCTGATTGCAG
CATTCGCAAATCTGCGCCTGTGAAATCCAGTTCTGTGAATGAAGCTTGTA
ACTGACCTCTGACTGANTTTTCCCAGTTATGGATCAACATTCCTAAATCT
GAACAACTGCATTGGCAAATAAGGAGGTGATTGAAACTCTTCCAATAACT
CAAGTGGNCCTTCTCCTGGGCGGAAAAACGTGGTTCTTGGATTCACTTCA
GGCTGGAGAACGAACCTTAAAACAAAAGAATCTTTTTCAAAGTTGAATAG
AAAATTCCTGCTTANGGAATTCAAAAAACCACCTTCCCGAAAATTCAAGG
AGACCCAGAAGGGGAAGATCCACCACTGGAAAAAACTTTGCTTTTAGGCT
TACCCAATGGCAGCTTTTACAAGGACCTCTTCAAAAGTTGACTTAAGAAG
ATTCAACCACTCNGGCTGTATCACCTAGTTTGAACGAACAGAGCTCTGTT
GCTGCAAGGACAGCTCTTTTGAAATGGANGATCATGTCATAGCCTACGTC
TGAATCAGGACCCAACATTCGATGAAGGAATCCCAGCAATGGAAATCAAG
ATCTGCTACGTCAAGACTCCTATAAAAAACCGCAACCTAACTCC
back to top