EY756111

Overview
NameEY756111
Unique NameEY756111
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length281
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2314 contig Csv1_Contig2314:14..294. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-003-G03-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756111 ID=EY756111|Name=EY756111|organism=Citrus sinensis|type=EST|length=281bp
CCACGCGTCCGGGCGCCGAGTGACACCAATAAGATGCATTCTCATTAAAT
GATATATTGTCTACTAACCCAGTAATGGGTTCCTGAGCTATCGAATGGAG
GAAATTGCTTGGAATCAGGAAGCAGCGAAATCCAGTAAAACTTTTTGATT
TAAATCGAGTAGATGTGCGTATGTTTATCATCCATTACACTACTGGACAT
GACTGTCTTATTGTTGTGGCTTTTAGCATGAGTACATACTGTACATTGAT
TAANAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top