EY756109

Overview
NameEY756109
Unique NameEY756109
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length307
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13305 contig Csv1_Contig13305:1..307. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-003-F11-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756109 ID=EY756109|Name=EY756109|organism=Citrus sinensis|type=EST|length=307bp
CCACGCGTCCGAAATCCTTGAATTTGCTCTAACTTACTCAAAGGACTAAA
GTTGGTGATTGCTCAAAGCTGCAAAAGGGAACGAAGGCTTAGTGTAGCTT
TTATGCTTTTGTTCACAGCATTCATTGTTTGAAGGTGAGATTTGAACAAT
TTTATAATGTTTCGGTGGATAGTTCGTGTTTTTTTGGGCAATTCTGGACA
AGAAGATTGCTAAGAACTTAAAAACAGAAATACGAATGCTTTCATTTCNN
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAA
back to top