EY756105

Overview
NameEY756105
Unique NameEY756105
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length269
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
EY756105_ssr49 microsatellite EY756105_ssr49:49..60.
Properties
Property NameValue
Genbank descriptionCS13-C1-001-003-F07-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756105 ID=EY756105|Name=EY756105|organism=Citrus sinensis|type=EST|length=269bp
CCACGCGTCCGATTACAAAATTGCATTACTAATAGCCTGTAACTACATTG
TATGTATGTATATTGGCCATCTATCACATCCTTATTTTTCCACCTCAAAT
CAACCAACCACCAAGCCGATAGAACCTTCTGGGACATGAGATTAACAGAC
ATTGAAAATACACTTTCTCCAAAGGGCGGCCGCTCTAAAGGAACCCTACT
TACATCCTCGAGTTTGGAACCACTTACCTCTTCGAAAGGGCCACCAAAAT
AAAATCCTCTGGCCAGATG
back to top