EY756100

Overview
NameEY756100
Unique NameEY756100
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length503
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:121..623. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS13-C1-001-003-E12-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756100 ID=EY756100|Name=EY756100|organism=Citrus sinensis|type=EST|length=503bp
TTCGTCGACCCACGCGTCCGAGCAACTTAATCTACTTTCGAACTTTGATT
CCCGTAAGCAGAGATCTTTCTGATTTGAAGAACATGGAAACCACCTGCGC
AGGTAATAACTGGTCAGAGGGTCTTCTGCTTCCTCCGTTTGGCAGTATTG
CTGATGATGATGTCATGAACGACAATCTTGATTTTCTTAATGTCCCCCAA
TATGGAAGAAACCCCGACTACATGGGTTAAGTGCAGCACTGCTTTTTTTT
TTTTCTGTTTTGTTTAATTAAATAAATGATAGGTATACTATTACCTATCA
ATCATGACAATGTTTTAGTATGGTTTAGTTCAACTTATAAGATTTCTTGA
GACGTACAAGCAATCTTTTTGTTTACTTTTGAGCTAAGTATTTTCCTGAA
AAAGGAAATAAATCAATAAAAGTTATTGTGTGTGTCNNNNANAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
NGG
back to top