EY756095

Overview
NameEY756095
Unique NameEY756095
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length362
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY756095_ssr144 microsatellite EY756095_ssr144:144..155. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig1193 contig Csv1_Contig1193:1223..1584. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA_TRYCR (Tubulin alpha chain OS=Trypanosoma cruzi PE=3 SV=1)

HSP 1 Score: 74.7146 bits (182), Expect = 1.613e-13
Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA_TRYBR (Tubulin alpha chain OS=Trypanosoma brucei rhodesiense PE=3 SV=1)

HSP 1 Score: 74.7146 bits (182), Expect = 1.613e-13
Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA_EUGGR (Tubulin alpha chain OS=Euglena gracilis GN=TUBA PE=2 SV=1)

HSP 1 Score: 74.7146 bits (182), Expect = 1.613e-13
Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA_DAUCA (Tubulin alpha chain OS=Daucus carota GN=TBA PE=2 SV=1)

HSP 1 Score: 74.7146 bits (182), Expect = 1.613e-13
Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA2_ORYSJ (Tubulin alpha-2 chain OS=Oryza sativa subsp. japonica GN=TUBA PE=2 SV=1)

HSP 1 Score: 74.7146 bits (182), Expect = 1.613e-13
Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA2_EMENI (Tubulin alpha-2 chain OS=Emericella nidulans GN=tubB PE=3 SV=2)

HSP 1 Score: 74.7146 bits (182), Expect = 1.613e-13
Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  401 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 434          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA1_PNECA (Tubulin alpha chain OS=Pneumocystis carinii GN=TUB1 PE=3 SV=1)

HSP 1 Score: 74.7146 bits (182), Expect = 1.613e-13
Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA1_ARATH (Tubulin alpha-1 chain OS=Arabidopsis thaliana GN=TUBA1 PE=2 SV=1)

HSP 1 Score: 74.7146 bits (182), Expect = 1.613e-13
Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA_WHEAT (Tubulin alpha chain OS=Triticum aestivum GN=TUBA PE=2 SV=1)

HSP 1 Score: 73.559 bits (179), Expect = 3.594e-13
Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            Y+KRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
BLAST of EY756095 vs. ExPASy Swiss-Prot
Match: TBA_TOXGO (Tubulin alpha chain OS=Toxoplasma gondii PE=3 SV=1)

HSP 1 Score: 73.559 bits (179), Expect = 3.594e-13
Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 1
Query:   13 YSKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 114
            Y+KRAFVHWYVGEGMEEGEFSEAREDLAALEKDY
Sbjct:  399 YAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDY 432          
The following BLAST results are available for this feature:
BLAST of EY756095 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 136
Match NameE-valueIdentityDescription
TBA_TRYCR1.613e-13100.00Tubulin alpha chain OS=Trypanosoma cruzi PE=3 SV=1[more]
TBA_TRYBR1.613e-13100.00Tubulin alpha chain OS=Trypanosoma brucei rhodesie... [more]
TBA_EUGGR1.613e-13100.00Tubulin alpha chain OS=Euglena gracilis GN=TUBA PE... [more]
TBA_DAUCA1.613e-13100.00Tubulin alpha chain OS=Daucus carota GN=TBA PE=2 S... [more]
TBA2_ORYSJ1.613e-13100.00Tubulin alpha-2 chain OS=Oryza sativa subsp. japon... [more]
TBA2_EMENI1.613e-13100.00Tubulin alpha-2 chain OS=Emericella nidulans GN=tu... [more]
TBA1_PNECA1.613e-13100.00Tubulin alpha chain OS=Pneumocystis carinii GN=TUB... [more]
TBA1_ARATH1.613e-13100.00Tubulin alpha-1 chain OS=Arabidopsis thaliana GN=T... [more]
TBA_WHEAT3.594e-1397.06Tubulin alpha chain OS=Triticum aestivum GN=TUBA P... [more]
TBA_TOXGO3.594e-1397.06Tubulin alpha chain OS=Toxoplasma gondii PE=3 SV=1[more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionCS13-C1-001-003-E07-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756095 ID=EY756095|Name=EY756095|organism=Citrus sinensis|type=EST|length=362bp
CCACGCGTCCGGTACTCGAAGAGGGCGTTTGTGCATTGGTATGTGGGTGA
AGGCATGGAGGAAGGAGAGTTTTCGGAGGCTAGAGAGGATTTGGCTGCAC
TTGAGAAGGATTACGAGGAAGTTGGTGCTGAGTCTGCTGACGGAGAAGAA
GAAGAAGGAGACGAGTACTAGGCAGTGATATTGGATTTGTTCTTCTGCCA
ATGGACTCATTGGTCTGCCCTCGCTATAATGGATGATACCAGACTCATAT
GTAGCCGAACCTATGCTCTTTTTGCCTCTTTTTCGTGTTATATATTAGGC
CCAAATGAGTTAACAAAATTTGCACTGTTTTCAACCTTTATTTATTATAT
ATTTGAGGCACA
back to top