EY756006

Overview
NameEY756006
Unique NameEY756006
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length283
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Alignments
Feature NameTypeLocationAnalysis
EY756006_ssr35 microsatellite EY756006_ssr35:35..46.
Csv1_Contig7925 contig Csv1_Contig7925:1012..1294. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-E07-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY756006 ID=EY756006|Name=EY756006|organism=Citrus sinensis|type=EST|length=283bp
CCCGCGTCCGATGGAAACTTACTATTGCAACAAGATCATCATCATCAGAG
GGTGATTTGGTCAGCTCTTTCTAAATAAGCTAGCTTGCAGCATATGCGCG
AGAGTTTTTGTGCTTAACAAACTCAAATTTAATCTGATCGTTTTGCCTGA
AACATGTTATGTACTTTCAAATAAATTAACGATCAAACTTGAGTTTAATC
TAATGGTCTTGTCTGAAAGATGTTATGTATTTTCAAATAGATTAATTAAA
CTTTTGTTTGTGTGTTCAAAAAAAAAAAAAAAA
back to top