EY755982

Overview
NameEY755982
Unique NameEY755982
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length552
Libraries
Library NameType
Sweet orange leaf, field plant Bcdna_library
Properties
Property NameValue
Genbank descriptionCS13-C1-001-002-C04-CT.F Sweet orange leaf, field plant B Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755982 ID=EY755982|Name=EY755982|organism=Citrus sinensis|type=EST|length=552bp
CCACGCGTCCGGCAGATAGGCTTTTGGAGATGGAAGATGAGGACTTGAAG
GCTGCAATAGCTGCGAGTCTGTTGGATTCTTCCCCAGCTAAGCCTACTGC
GGAAGCCAGCAGCACCACATCAAGACCTCTCTCACTCAGCCACTCCTCCC
TCCATCTACTGAAAATGTTTGATCAGAAAAAGGACCCTAACTTTCATCTA
AATTTGGCAACAGCTGGTAAACAAAATGTACCCGGAAAAGAAATCACCAA
AAAAAAAAAAAAAAATGCACTACCCTATGAACTATTAAAGTTTGTGTGTG
TATGAAGTTGCTTTCACTTTTTTTTTCTTGGTTTTTTTTTTCCCCTTTAT
GGGCTAGTACTTGATCAGTTTCTCTAAGTAGCAGAAAAAGAAAAAAGAGA
GTTTTTCAAGGGGGATGAGTCTGATATTCATCGTCGTCCCATATGCTTGA
TGTGTTAATTTATGGTTTGAAACTTTTGAGAAGAAAGATATGCACATGAT
TATTATGAAGCTAAAAAAAAAAAAAAAAAAANNAAAAAAAAAAAAAAAAA
AA
back to top