EY755699

Overview
NameEY755699
Unique NameEY755699
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length877
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13270 contig Csv1_Contig13270:1..880. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-031-E09-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755699 ID=EY755699|Name=EY755699|organism=Citrus sinensis|type=EST|length=877bp
CTGGCCATCACATGTGCTCAGAATTTGTTTGTACTCGAGTTCCTCGTTTG
TATAAAAGGAAGTGAAAATGTGTAGTTAATTATAAGGCAGAAAAAAAATT
TAAAGATATATTTTTTATTAAAATCACAGACGATATACTTTAAATGGCGT
CTGTTCAGGTGAATATGTCTGCGTCCCTTCCGGCGAAGGCGTTTTGTCGT
CGCAAATTGACAGGATACACGGCGTCTGCGACTTTTCCGTTGAAGGCGTC
TGCGTCTTTTCCGTTGAAGGCGTCTGCTTCTGTTCCATTGAGGGCGTCTG
ATGTGGATAAGGTGTCTGGTAATAAGAAATTAACAAATTTTAAATCAGAT
TACGTTTTTATATTTTATTCTGGTCCAGAAAATTTGAAGAGGTACGATAG
GATGGATTTTGGTTTATATGGTCGGAGTTGGCTTGCTAATGCTTCTTGGT
CCCTCGTATTTGCTCCTGGCGTCAACGAGGATAATTGGAAAGACTATCTA
CTTCCTGCAAAATCAAATTTTATGGACACGGGAGATTTGCTTAATGTTGT
TGGATCTGGTTCTTCCAATGGACTTCTATTTGCTGTTAGTGCCAAAAGTT
TTCATAAACGTGCTGTTCATGGCATTAAAACTTTGATTNCATTGGACGAA
GTGAAGAATGATAGTCGTCTTAAGGCTGGAGGTTCTCTCCTTGTGAATAT
TGCTCTTTTANCAATGAACGAAGATGGTGAAGTTCGTGCGGATACTGATT
ATACTTTTGATGGGTACGTGTCCTGGAACTGTATTTGAGTTGAATATATG
AGTATGGTCTTACCTAAGATAGGGGATGTGTCAATCATAAAAGGGTGGAA
AAGGGGGGCAGGGCCCTTTAACCTTGT
back to top