EY755477

Overview
NameEY755477
Unique NameEY755477
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length854
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-028-G04-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755477 ID=EY755477|Name=EY755477|organism=Citrus sinensis|type=EST|length=854bp
AAAGTATAAAGACAAAAGAAGAACCATGAACGTGGAAGAAGAGGTAGAGC
GACTCAAGGAGGAAATCCAACGACTTGGCAAGATCCAACCTGATGGCTCT
TACAAGGTTTCATATATATCTCTCCCTATCTATCTCTGGATTTGAATTTG
TTTTGTTTGTTAACATTTTAATATGATGCTTGATTTAGACCCCCGTATAT
GATGCTTGATTTAGACCCCCATAGCCCATATTACGTTACTAAATTTGCTG
GGATTGAACTGCAGTTGATACATTTGGAGCATGTCAAGGGCAGATCTTTG
GTCATATAGTTTTAACATTTTCATCACTGCTCGGATTTTTCTGATAATGG
ATATGGCTAATGAATCTGTTGAGCTTTAAGCTAAATATTTAGGATGGGAG
ATTGTACTTTTGTTCTTCTGGTAAAAAATGTGTGACTAATAACTGCTAAT
ATCGAGATTAAACCAAATTTTGAGGGTAGAAGAACTTGTATTTTTCAAAA
ATTTCAACTAGTTTAGAAGTTGATTAATTTTGATTCTGCTAATATCCATG
GATGTAATGATGTGATATGACATTATGAAATGATTTGAGATTTTTTACCT
CTTCAGCAAGAATTGACTTGCCTCCCANGAACTAATTCTGTCAATCCAAC
CTTGTTTATTTTATTTAATGTTGTTTTCCGTGAATACATGATTTGTTGTT
ACATTTTTATTCAGATTTTGTTTATCTGTGTCTGAGTAAGAAATTCGAGT
GATATTTATTGATGTCAATCAATAACAAATGATCTCAGTACTAGTCAACA
CTGATGGCTCCAAATTGTGATGGTCAATTTTGTTGGATTGAATTCGANAT
GAAA
back to top