EY755474

Overview
NameEY755474
Unique NameEY755474
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length963
Alignments
Feature NameTypeLocationAnalysis
EY755474_ssr588 microsatellite EY755474_ssr588:588..597.
Libraries
Library NameType
Sweet orange leaf, field plant Acdna_library
Properties
Property NameValue
Genbank descriptionCS12-C1-001-028-G01-CT.F Sweet orange leaf, field plant A Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY755474 ID=EY755474|Name=EY755474|organism=Citrus sinensis|type=EST|length=963bp
GGGGGGGGAGTAANNGAATGGCTGTCGGCGCCCCCTGTGGACTGGTAACA
AACGCAGTTTTCTGGTCCGGGATTCCCCCGTCGACCCAGCGTCCGCGAAA
AGTAAACGAAAGACACCACAAATCAAAAGTTCAATGGCAGCGACGGCGAA
CGCGGCAGTGTTAACTCCACGTGTCCCCTCAACCACCACCGTCAAAGTCA
AATCTTCTCACTGCTTTGCTCTTCCCTGCCTCCCTCCTCGTTCGTCAACG
TCACCATTGTCTTCTTCCATTAAACAAGTTACAGAGTCGAGAAGGTCTCC
TTTGCTTCAGGTTAGAGCCTCTACCTCATAATAGACATCCACAGTTGATG
CAGATGAACTTTTTTCAGACTTGAAGGAAAATTGGGATGCCGTTTAAAAC
AAGTTCACGGTACTTATTTATGGAGGTGGGGTAATAATGGATGTTTTAGT
TATTCTTAAAATTGTTATTTTAATAAATTTAATTTTTTTTTTTATAAACT
TTAAAATTAGATTCGACTATCTTATACTGTCTGCCTGGGTTACATAATTC
CTTTCCTCATAGGCACCACTAAAAAAATACAGACACTTATATATATACCT
CTAATACTTAACATTCTTGCAATTAATAAAAAATCACTTTTCCGACCCAT
TCTCTCCACCACACACAAAAACAACACCAAATAGCACAACTCCAAATGAA
AACAAAGACGGCACAATCCATAAACAAGTAATCGTAACCGCCTAGAAGGA
CTTCCTTAATAATCACTGAAGACAGTCAAAACAGTTTCACCGCACCACTC
TAGCCCTTTCATCCCCGTCCTTCTCCCGCGGTCCCTTATGTCGGTCTTGT
AAAACATATCAGTTATTTCTACATATCCACCCTCATACCCTCCACCACAC
ATTTCACCTTCTCCACCCCATACCTCCGCATTACCCGTAAAAAGACCGAC
ACACCAAACACCA
back to top