EY728710

Overview
NameEY728710
Unique NameEY728710
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length883
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-007-E12-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728710 ID=EY728710|Name=EY728710|organism=Citrus sinensis|type=EST|length=883bp
CCACGCGTCCGGCGCATTGCTAGAATCTCTGCTCATCTTTACCCTCCAAA
TCTCCAGGTATTTACATGTATTATTGTTCTTCAATAGTGTGTTTTATTTA
TGAATCTTTTATCATATGATATGGTGACTCATTCTTTGCATATGGTTTAA
TTGTTTTCTGGGTCATGGCTGTTGTTTTTGTGCACATATATACCAAGAGT
ATTTTGTTTGGGATTGTGGCATCCTGGCTTAAATATGATAGTTGCTTGCT
GTACTCAAAGCTCAAGCCCTCTAAGAAAAAATTAATGAGTGATTTCATAA
ATACCTCTGGATGTTAGTTTTAGCATATTGGGATGTTGTAGTATTTTTAA
TAGAGAATAAAATCACTTGCTGTCAAATATAAATGAGTGGGTAACGGCAA
CAAATATTATCTGCCAAATAAAAACTATTGCTAATCACCTTTTAACTGCT
GTGTTTTTCAATGTCAAAGTAGAAGTAACGCTCTACCCATCAGATTATTA
ATAATTCATAAGAAGAGTAATTAACTCCAATTTTTTTTATAGCCAAAATT
GCTTTGTCTGGGGTCAGTTCATATATATCANGAATTGAATAAATTGAGAA
TGGAGTCTACTGTTCATATTTGTATTGTGTATACATTTTGGTGGACGTTA
GAGATCAAATTATTACTACTGAATTTGTTGGATGTGCTCTGTGGATTGTG
TGCTGGTGAATGGAGGAGAATCTTGCTTGAGGCAGCTAAATGCCGGGCAA
AGGGCGGGCAGCTGGATTCCAAATNCCATCTTGGGTGCTGCTGAGGCATG
GGTCACCCCTTGGCATGCTAATGAAAATAACCCCCTGTTCCCATCCTTCC
CCCTATAATGTTTCAAAACCCTGGTGTCCTCCT
back to top