EY728704

Overview
NameEY728704
Unique NameEY728704
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length285
Alignments
Feature NameTypeLocationAnalysis
EY728704_ssr138 microsatellite EY728704_ssr138:138..159.
EY728704_ssr227 microsatellite EY728704_ssr227:227..238.
Csv1_Contig7126 contig Csv1_Contig7126:897..1181. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-007-E04-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728704 ID=EY728704|Name=EY728704|organism=Citrus sinensis|type=EST|length=285bp
CCACGCGTCCGCGGACGCGTGGGTATAGCTTAATTTAGATAGACCTTAAA
TTGTTATATCATATTATCATATATGAACATGATTAGGTAATTCTTTTTTT
TCCTATGTTTATTTATGTGAGTTTTGGGTAAAGAATTTATATATATATAT
ATATATATAGTTAAGTACTAATTGAGGGGAGTGAGATTCACAGTGACTAT
GTTCCATTCATAGCCTCTTGATGTAATTGTTGTTGTTGTATGATATATGA
AAGGGATTTTTAGTTAAAAAAAAAAAAAAAAAAAA
back to top