EY728599

Overview
NameEY728599
Unique NameEY728599
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length120
Libraries
Library NameType
Sweet orange fruit, development stadium (5 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-704-006-A06-CT.F Sweet orange fruit, development stadium (5 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY728599 ID=EY728599|Name=EY728599|organism=Citrus sinensis|type=EST|length=120bp
CCACGCGTCCGGATTTTTTGTTTCAGTTTTCATTCATTATTATGCTTTTA
GCTTTGTTTGAGTACTCACAAATCCAATTTGAGGCTAGTTTTATTTCTTA
AAAAAAAAAAAAAAAAAAAA
back to top